Prepared Control Oligos

Standard Control Oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.

Short Description: 
Negative control oligo
Oligo sequence: 
CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
259160.00
Molecular Weight: 
8328.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
0.002 lb
Restricted Item: 
Public
SKU:
PCO-StandardControl-100

Vivo-Morpholino Standard Control Oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.

Short Description: 
Negative Vivo-Morpholino control oligo
Oligo sequence: 
CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications: 
100 nmol
Product variations: 
$150.00
Molar Absorptivity: 
259160.00
Molecular Weight: 
8328.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-VivoStandardControl-100

Random Control Oligo 25-N

These 25-base mixed oligos are synthesized with a random base mixture at every position. They are intended for use as a negative control. The concentration of any given sequence in this mixture should be well below the threshold of detectable biological activity.

Short Description: 
25-base random sequence mixture
Oligo sequence: 
NNNNNNNNNNNNNNNNNNNNNNNNN
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
0.00
Molecular Weight: 
8463.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-RandomControl-25N-100

Zebrafish p53 oligo

This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics).

Short Description: 
Danio rerio apoptosis suppression oligo
Oligo sequence: 
GCGCCATTGCTTTGCAAGAATTG
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
236990.00
Molecular Weight: 
7804.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-ZebrafishP53-100

Zebrafish Chordin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.

Short Description: 
Danio rerio Chordin positive control oligo
Oligo sequence: 
ATCCACAGCAGCCCCTCCATCATCC
Size and End-Modifications: 
100 nmol with 3' Fluorescein
Product variations: 
$150.00
Molar Absorptivity: 
250880.00
Molecular Weight: 
8742.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-ZebrafishChordin-100-F

Clawed Frog Beta Catenin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for knockdown of Beta Catenin in frog embryos.

Short Description: 
Xenopus laevis Beta Catenin antisense oligo
Oligo sequence: 
TTTCAACCGTTTCCAAAGAACCAGG
Size and End-Modifications: 
100 nmol with 3' Fluorescein
Product variations: 
$150.00
Molar Absorptivity: 
262740.00
Molecular Weight: 
8901.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-BetaCatenin-100-F

Clawed frog p53 Oligo

This is a Morpholino oligo targeting Xenopus laevis p53.

Short Description: 
Xenopus laevis p53 oligo
Oligo sequence: 
GCCGGTCTCAGAGGAAGGTTCCATT
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
256200.00
Molecular Weight: 
8500.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-ClawedFrogP53-100

Green Fluorescent Protein Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description: 
Translation blocker for GFP target
Oligo sequence: 
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
246420.00
Molecular Weight: 
8275.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-GFPControl-100

Vivo-Morpholino GFP Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description: 
Translation blocker for GFP target (Vivo-Morpholino)
Oligo sequence: 
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications: 
100 nmol
Product variations: 
$150.00
Molar Absorptivity: 
246420.00
Molecular Weight: 
8275.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-VivoGFPControl-100

Photo-Morpholino GFP Positive Control

This Photo-Morpholino shares the same target as the Green Fluorescent Protein positive control. This Photo-Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description: 
Translation blocker for GFP target (Photo-Morpholino)
Oligo sequence: 
ACAGCTCCTCaaPaaTGCTCACCAT
Size and End-Modifications: 
100 nmol
Product variations: 
$150.00
Molar Absorptivity: 
255910.00
Molecular Weight: 
8237.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-PhotoGFPControl-100

gal4-uas Morpholino Oligo

This Morpholino oligo is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence). This oligo targets the most frequently used gal4-UAS sequence and has been validated in Tallafuss et al.

Short Description: 
gal4-uas Morpholino oligo
Oligo sequence: 
GTTCGATAGAAGACAGTAGCTTCAT
Size and End-Modifications: 
100 nmol
Product variations: 
$100.00
Molar Absorptivity: 
266090.00
Molecular Weight: 
8507.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-gal4-100

gal4-uas Photo-Morpholino Antisense Oligo

This Photo-Morpholino shares the same target as the gal4-uas Morpholino oligo. This Photo-Morpholino is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence) and has been validated in Tallafuss et al.

Short Description: 
gal4-uas Photo-Morpholino antisense oligo
Oligo sequence: 
GTTCGATAGAtaPatGTAGCTTCAT
Size and End-Modifications: 
100 nmol
Product variations: 
$150.00
Molar Absorptivity: 
259530.00
Molecular Weight: 
8393.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-gal4AntisensePhoto-100

gal4-uas Photo-Morpholino Sense Oligo

This sense complementary Photo-Morpholino pairs with the gal4-uas Morpholino oligo. When paired with the gal4-uas Morpholino oligo, it will block the gal4-uas Morpholino oligo from binding the gal4-uas RNA target.

Short Description: 
gal4-uas sense Photo-Morpholino
Oligo sequence: 
ATGAAGCTACaaPaaTCTATCGAAC
Size and End-Modifications: 
100 nmol
Product variations: 
$150.00
Molar Absorptivity: 
268450.00
Molecular Weight: 
8349.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-gal4SensePhoto-100