Prepared Control Oligos

Standard Control Oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.

Short Description
Negative control oligo
Oligo sequence
CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
259160.00
Molecular Weight
8328.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
0.002 lb
Restricted Item
Public
SKU:
PCO-StandardControl-100

Vivo-Morpholino Standard Control Oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.

Short Description
Negative Vivo-Morpholino control oligo
Oligo sequence
CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
259160.00
Molecular Weight
8328.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-VivoStandardControl-100

Random Control Oligo 25-N

These 25-base mixed oligos are synthesized with a random base mixture at every position. They are intended for use as a negative control. The concentration of any given sequence in this mixture should be well below the threshold of detectable biological activity.

Short Description
25-base random sequence mixture
Oligo sequence
NNNNNNNNNNNNNNNNNNNNNNNNN
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
0.00
Molecular Weight
8463.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-RandomControl-25N-100

Zebrafish p53 oligo

This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics).

Short Description
Danio rerio apoptosis suppression oligo
Oligo sequence
GCGCCATTGCTTTGCAAGAATTG
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
236990.00
Molecular Weight
7804.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ZebrafishP53-100

Zebrafish Chordin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.

Short Description
Danio rerio Chordin positive control oligo
Oligo sequence
ATCCACAGCAGCCCCTCCATCATCC
Size and End-Modifications
100 nmol with 3' Fluorescein
Product variations
$150.00
Molar Absorptivity
250880.00
Molecular Weight
8742.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ZebrafishChordin-100-F

Clawed Frog Beta Catenin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for knockdown of Beta Catenin in frog embryos.

Short Description
Xenopus laevis Beta Catenin antisense oligo
Oligo sequence
TTTCAACCGTTTCCAAAGAACCAGG
Size and End-Modifications
100 nmol with 3' Fluorescein
Product variations
$150.00
Molar Absorptivity
262740.00
Molecular Weight
8901.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-BetaCatenin-100-F

Clawed frog p53 Oligo

This is a Morpholino oligo targeting Xenopus laevis p53.

Short Description
Xenopus laevis p53 oligo
Oligo sequence
GCCGGTCTCAGAGGAAGGTTCCATT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
256200.00
Molecular Weight
8500.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ClawedFrogP53-100

Green Fluorescent Protein Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description
Translation blocker for GFP target
Oligo sequence
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
246420.00
Molecular Weight
8275.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-GFPControl-100

Vivo-Morpholino GFP Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description
Translation blocker for GFP target (Vivo-Morpholino)
Oligo sequence
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
246420.00
Molecular Weight
8275.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-VivoGFPControl-100

Photo-Morpholino GFP Positive Control

This Photo-Morpholino shares the same target as the Green Fluorescent Protein positive control. This Photo-Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description
Translation blocker for GFP target (Photo-Morpholino)
Oligo sequence
ACAGCTCCTCaaPaaTGCTCACCAT
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
255910.00
Molecular Weight
8237.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-PhotoGFPControl-100

gal4-uas Morpholino Oligo

This Morpholino oligo is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence). This oligo targets the most frequently used gal4-UAS sequence and has been validated in Tallafuss et al.

Short Description
gal4-uas Morpholino oligo
Oligo sequence
GTTCGATAGAAGACAGTAGCTTCAT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
266090.00
Molecular Weight
8507.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-gal4-100

gal4-uas Photo-Morpholino Antisense Oligo

This Photo-Morpholino shares the same target as the gal4-uas Morpholino oligo. This Photo-Morpholino is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence) and has been validated in Tallafuss et al.

Short Description
gal4-uas Photo-Morpholino antisense oligo
Oligo sequence
GTTCGATAGAtaPatGTAGCTTCAT
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
259530.00
Molecular Weight
8393.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-gal4AntisensePhoto-100

gal4-uas Photo-Morpholino Sense Oligo

This sense complementary Photo-Morpholino pairs with the gal4-uas Morpholino oligo. When paired with the gal4-uas Morpholino oligo, it will block the gal4-uas Morpholino oligo from binding the gal4-uas RNA target.

Short Description
gal4-uas sense Photo-Morpholino
Oligo sequence
ATGAAGCTACaaPaaTCTATCGAAC
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
268450.00
Molecular Weight
8349.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-gal4SensePhoto-100