Green Fluorescent Protein Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description
Translation blocker for GFP target
Oligo sequence
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
246420.00
Molecular Weight
8275.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-GFPControl-100