Vivo-Morpholino Standard Control Oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.

Short Description
Negative Vivo-Morpholino control oligo
Oligo sequence
CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
259160.00
Molecular Weight
8328.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-VivoStandardControl-100