Clawed Frog Beta Catenin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for knockdown of Beta Catenin in frog embryos.

Short Description
Xenopus laevis Beta Catenin antisense oligo
Oligo sequence
TTTCAACCGTTTCCAAAGAACCAGG
Size and End-Modifications
100 nmol with 3' Fluorescein
Product variations
$150.00
Molar Absorptivity
262740.00
Molecular Weight
8901.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-BetaCatenin-100-F