Zebrafish p53 oligo

This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics).

Short Description
Danio rerio apoptosis suppression oligo
Oligo sequence
GCGCCATTGCTTTGCAAGAATTG
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
236990.00
Molecular Weight
7804.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ZebrafishP53-100