Zebrafish Chordin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.

Short Description
Danio rerio Chordin positive control oligo
Oligo sequence
ATCCACAGCAGCCCCTCCATCATCC
Size and End-Modifications
100 nmol with 3' Fluorescein
Product variations
$150.00
Molar Absorptivity
250880.00
Molecular Weight
8742.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ZebrafishChordin-100-F