Vivo-Morpholino GFP Positive Control

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

Short Description
Translation blocker for GFP target (Vivo-Morpholino)
Oligo sequence
ACAGCTCCTCGCCCTTGCTCACCAT
Size and End-Modifications
100 nmol
Product variations
$150.00
Molar Absorptivity
246420.00
Molecular Weight
8275.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-VivoGFPControl-100