Zebrafish Chordin Positive Control Oligo

This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.

Short Description: 
Danio rerio Chordin positive control oligo
Oligo sequence: 
ATCCACAGCAGCCCCTCCATCATCC
Size and End-Modifications: 
100 nmol with 3' Fluorescein
Product variations: 
$150.00

Show more details

Molar Absorptivity: 
250880.00
Molecular Weight: 
8742.00
Harmonizing Code: 
2934999000
Shipping Commodity Description: 
Synthetic non toxic reagent
Country of Origin: 
US
Physical Weight: 
1 g
Restricted Item: 
Public
SKU:
PCO-ZebrafishChordin-100-F