gal4-uas Morpholino Oligo

This Morpholino oligo is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence). This oligo targets the most frequently used gal4-UAS sequence and has been validated in Tallafuss et al.

Short Description
gal4-uas Morpholino oligo
Oligo sequence
GTTCGATAGAAGACAGTAGCTTCAT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
266090.00
Molecular Weight
8507.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-gal4-100