Clawed frog p53 Oligo

This is a Morpholino oligo targeting Xenopus laevis p53.

Short Description
Xenopus laevis p53 oligo
Oligo sequence
GCCGGTCTCAGAGGAAGGTTCCATT
Size and End-Modifications
100 nmol
Product variations
$100.00
Molar Absorptivity
256200.00
Molecular Weight
8500.00
Harmonizing Code
2934999000
Shipping Commodity Description
Synthetic non toxic reagent
Country of Origin
US
Physical Weight
1 g
Restricted Item
Public
SKU:
PCO-ClawedFrogP53-100